Table of Contents

1. Summary

2. Crop Rotation Studies

3. Disease and Pest Control

4. Soil Fertility and Nutrition

5. Optimum Storage Conditions

6. Storage Diseases

7. Increasing Sugar Contents

8. Marketing Studies

9. Sensory Evaluations

10. Carrot Processing Projects

Carrot (Daucus carota L.) is one of the most promising alternative crops for North Dakota. Due to the favorable environmental and soil conditions, carrots grown in ND and the surrounding region are known for quality with high sugar content and intense pigmentation. While our carrots are gaining popularity in national and international markets, commercial production in the state declined from 2,500 acres in 1996 to less than 100 acres in 1997. This drastic reduction in acreage occurred following the fire at the dehydration plant in Fosston, MN, in the spring of 1997. This dehydration facility played an important role in absorbing massive quantities of carrots which were not sold through fresh markets. A new dehydration plant, capable of handling twice as much capacity of the old facility, is expected to be rebuilt in 1998. It is anticipated that carrot production in the state will increase again this year. As new packaging and processing companies consider moving into the region, the carrot industry is expected to expand gradually in the next several years.

Many of the first time carrot farmers lack experience in growing this crop and need cultural information that are unique to this region. The overall goals of this research include a) development of cultural information suitable for this region, b) optimize carrot storage conditions to expand the marketing window, c) enhancement of carrot germplasm for higher sugar contents, and d) assessment on the competitiveness of North Dakota-grown carrots in the domestic and international markets. In 1997, we initiated research in five specific areas as outlined in the proposal: crop rotation studies (Greenland), disease and pest control (Gudmestad, Stack, Weiss), soil fertility and plant nutrition (Cihacek, Lee), increasing sugar content (Duysen, Lee), optimum storage conditions (Hellevang, Stack), and marketing studies (Koo, Radke, Kraenzel).

Some of the highlights of our research progress include: 1) establishment of a large crop rotation plot (11 different crops) with an overhead sprinkler irrigation system from which the incidence of disease development can be monitored, 2) adoption of an experimental PCR protocol using DNA probe to detect aster yellows disease infection, 3) use of petiole saps to predict nutrient status in commercial fields, 4) development of transgenic plants that carry the antisense constructs of genes involved in sucrose metabolism, 5) compilation of an extensive literature on environmental control for carrot storage facility, and 6) finding that North Dakota-grown carrots have competitive edge in Japan and other Asian countries where market prices are twice as high as our domestic prices. We expect that more important information will be obtained by the time the second year research is completed in 1998.

Throughout the year, we have interacted with carrot growers in the region (about 1000 acres in the Red River Valley), establishing observation plots, monitoring pest problems, collecting tissue and soil samples, providing cultural advice, and participating in field days. This progress report will be shared with current and future carrot growers. A carrot home page (http://www.ndsu.nodak.edu/instruct/chlee/research/carrot) was established to disseminate our research findings and other timely information to vegetable growers through the internet.

Establishment Crop Rotation Site at Oakes Irrigation Research Station

Richard Greenland, Oakes Irrigation Research Station

Introduction

Vegetables are often produced under clean tillage conditions, and the potential for soil erosion is great. Crop rotations and the cover crops planted with and between crops in a rotation will have a big impact on soil erosion, and on yield and quality of the vegetables. Using rotations is a recognized way to control many pests. By controlling these pests, yields and quality of the carrots are improved and the need for pesticides is reduced. Carryover of herbicides from the previous crop to carrots is also a concern. Daniels, et al., Chase and Zandstra, and Greenland found herbicide carryover was dependent on the herbicide used, the soil pH, and other factors. Much research still needs to be done in this area. Information is very limited on crop rotations and cover crops used in vegetable rotations for North Dakota. This research will provide much needed information for carrot producers.

Objectives

The major objective for the Oakes Irrigation Research Station (OIRS) part of the study was to establish a crop rotation on a 68-acre tract involving carrots, other vegetables, and field crops. From this rotation, and other studies, we will determine the effects of previous crops, and the chemicals, managements, etc. used on those crops, on crops planted in subsequent years. We will also develop and define other cultural practices used in the rotation such as bed formation, planting of a cover-crop with the carrots to help prevent wind erosion, and weed control options.

The rotation study and other areas on the OIRS will provide area for other NDSU researchers to do research on: 1) disease and insect control; 2) soil fertilizer treatments; and 3) treatments to enhance carrot storage.

We will continue research to determine the best carrot varieties for use in cello pack, cut and peel baby carrots, true baby carrots, and for processing into carrot sticks, drying, etc.

Materials and Methods

In the spring of 1997, we divided a 68-acre sprinkler irrigated tract into 360 plots plus alleyways (so we could access each plot individually). Each plot was 30 ft wide by 145 ft long (about 0.1 acre). We established twenty-one 4-year rotations and two 3-year rotations on these plots. Thirteen of these rotations included carrots. The study had four replications. Each rotation was duplicated three or four times in each replication so that each crop in each rotation was planted each year. Figure 1 shows a map of the study and Table 1 lists the rotations used. Initial field preparation included a blanket fertilizer application of 81 lbs N, 70 lbs P₂O₅, 94 lbs K₂O, and 19 lbs S. The entire study was chisel plowed and disked. Carrot beds were formed May 15-16. We formed carrot beds with a bed former pulled by a tractor. The first beds formed were not satisfactory. An irrigation to moisten the soil and increasing the speed we drove the tractor produced good beds. 'Pak Mor' carrots were planted on May 16. Fusilade (fluazifop-P) sprayed on June 12 and Lorox (linuron) sprayed on June 18 did a fair job of controlling weeds. We sprayed asana on July 15 and on August 22 to control leafhopper. These applications of Asana were sprayed later in the year and at less frequent intervals than is normally done in carrot production so Beth Ann Hagen, from NDSU, could monitor insect, especially leafhopper, activity. On Oct. 20, 1997, Benlate (benomyl) was sprayed on selected half-plots in the rotation study. Carrots from the Benlate treated areas and from untreated areas were harvested on Oct. 30 and sent to Dr. Stack at NDSU for analysis to determine the effect of Benlate on certain storage rots in carrot.

In a separate study at the OIRS, Accent (nicosulfuron), Broadstrike (flumetsulam), and Scorpion III (flumetsulam plus clorpyralid plus 2,4-D) were applied to corn, and Pursuit (imazethapyr) and Raptor (imazamox) were applied to soybean in 1996. We applied these herbicides at 1, 2 and 4 times the standard application rate. Other than the herbicide applications, we grew the corn and soybean using standard management practices. In 1997, vegetables, including carrots, were planted where we grew the corn or soybean in 1996. Standard procedures were used in growing the vegetables. We monitored the vegetables throughout the season and took yields to determine the effect of carryover from the herbicides applied to the corn and soybean on the vegetables planted one year later.

We planted four carrot variety studies at the Oakes Irrigation Research Station to evaluate carrot variety performance under North Dakota conditions. We planted seven true baby carrot varieties, 27 cello varieties, 21 baby cut and peel varieties, and 27 processing type varieties. This was similar to the study planted in 1996.

Beth Ann Hagen monitored additional sites on the OIRS for carrot weevil activity. These sites had been planted to carrot in 1996 and were, therefore, the most likely areas for carrot weevil activity to occur.

Results

In our carrot management experiences, we found that proper soil moisture is required for good bed formation. Planting a barley cover crop on the beds with a regular drill was determined to be infeasible.
In the study on herbicide carryover, we found that Broadstrike applied to corn and Pursuit applied to soybean in 1996, stunted carrots planted in 1997. Accent, Scorpion III, and Raptor did not injure carrots planted one year after herbicide application. None of the herbicides tested reduced root size, root number, or yield of carrots.

Results of the cooperative work with NDSU personnel are found elsewhere in this report.

Because of equipment problems and a late planting date, carrot emergence was poor in the 1997 carrot variety performance trial. The data was too variable for analysis. Although this year did not produce usable results, similar studies in previous years have identified many carrot varieties suitable for commercial production in North Dakota. We reported these results in the Oakes Irrigation Research Station annual reports for 1996 and 1995.

Activities with the private sector

Most of the pest control chemicals and seed used in the rotation study was donated by various chemical and seed companies. All of the seed in the variety performance trials was donated by seed companies.

Major activities planned for 1998-99

We will continue the rotation as laid out except that tomatoes and pumpkin will be replaced with peppers and winter squash. We are designing a grain drill mounted to the carrot planter so a cover crop can be planted with the carrots. We will also test a way to apply and incorporate Treflan (trifluralin) herbicide on the carrot beds for added weed control in carrots. We will continue to provide space in the rotation study and cooperate with researchers from NDSU to do their related studies. Areas outside the rotation study will also be made available if needed.

The study examining carryover effect of herbicides applied to corn and soybean will be continued to determine injury to vegetables planted two years after herbicide application. We will conduct a variety performance trial similar to the ones conducted in 1995-1997.

Publications

1. Greenland, R.G., L.E. Besemann, H. Kerlin. 1998. Oakes Irrigation Research Station 1997 annual report.

Literature cited

Chase, W.R. and B.H. Zandstra. 1996. Carryover effects of imazamox on vegetable crops. 1996 North Central Weed Science Society Proceedings.

Daniels, D., T.O. Ballard, and S.C. Weller. 1996. Soil carryover studies in vegetable crops with AC 299,263 and imazethapyr. 1996 North Central Weed Science Society Proceedings.

Greenland, R.G. 1995. Carryover of flumetsulam, imazethapyr and nicosulfuron into six vegetables. 1995 North Central Weed Science Society Proceedings.

Greenland, R.G and L.E. Besemann. 1996. Carrot cover crop study. Oakes Irrigation Field Trials 1995 annual report, p. 57.

Leroux, G.D., Benoit, D.L. and S. Banville. 1996. Effect of crop rotations on weed control, Bidens cernua and Erigeron canadensis populations, and carrot yields in organic soils. Crop Protection 15:171-178.

Table 1. Rotations for the Oakes Irrigation Research Station rotation study, 1997 to 2000.

Rotation Treatment Crop planted in each year of the rotation

number number 1997 1998 1999 2000

1 1 carrot cabbage potato onion

2 cabbage potato onion carrot

3 potato onion carrot cabbage

4 onion carrot cabbage potato

2 5 carrot onion cabbage sweet corn

6 onion cabbage sweet corn carrot

7 cabbage sweet corn carrot onion

8 sweet corn carrot onion cabbage

3 9 carrot potato sweet corn cabbage

10 potato sweet corn cabbage carrot

11 sweet corn cabbage carrot potato

12 cabbage carrot potato sweet corn

4 13 carrot sweet corn onion potato

14 sweet corn onion potato carrot

15 onion potato carrot sweet corn

16 potato carrot sweet corn onion

5 17 cabbage onion sweet corn potato

18 onion sweet corn potato cabbage

19 sweet corn potato cabbage onion

20 potato cabbage onion sweet corn

6 21 carrot field corn cabbage dry bean

22 field corn cabbage dry bean carrot

23 cabbage dry bean carrot field corn

24 dry bean carrot field corn cabbage

7 25 carrot dry bean cabbage field corn

26 dry bean cabbage field corn carrot

27 cabbage field corn carrot dry bean

28 field corn carrot dry bean cabbage

8 29 onion field corn potato dry bean

30 field corn potato dry bean onion

31 potato dry bean onion field corn

32 dry bean onion field corn potato

Table 1. Rotations for the Oakes Irrigation Research Station rotation study, 1997 to 2000 (continued).

Rotation Treatment Crop planted in each year of the rotation

number number 1997 1998 1999 2000

9 33 onion dry bean potato field corn

34 dry bean potato field corn onion

35 potato field corn onion dry bean

36 field corn onion dry bean potato

10 37 carrot sugarbeet cabbage pumpkin

38 sugarbeet cabbage pumpkin carrot

39 cabbage pumpkin carrot sugarbeet

40 pumpkin carrot sugarbeet cabbage

11 41 carrot pumpkin cabbage sugarbeet

42 pumpkin cabbage sugarbeet carrot

43 cabbage sugarbeet carrot pumpkin

44 sugarbeet carrot pumpkin cabbage

12 45 onion sugarbeet potato pumpkin

46 sugarbeet potato pumpkin onion

47 potato pumpkin onion sugarbeet

48 pumpkin onion sugarbeet potato

13 49 onion pumpkin potato sugarbeet

50 pumpkin potato sugarbeet onion

51 potato sugarbeet onion pumpkin

52 sugarbeet onion pumpkin potato

14 53 carrot soybean cabbage tomato

54 soybean cabbage tomato carrot

55 cabbage tomato carrot soybean

56 tomato carrot soybean cabbage

15 57 carrot tomato cabbage soybean

58 tomato cabbage soybean carrot

59 cabbage soybean carrot tomato

60 soybean carrot tomato cabbage

16 61 onion soybean sweet corn tomato

62 soybean sweet corn tomato onion

63 sweet corn tomato onion soybean

64 tomato onion soybean sweet corn

Table 1. Rotations for the Oakes Irrigation Research Station rotation study, 1997 to 2000 (continued).

Rotation Treatment Crop planted in each year of the rotation

number number 1997 1998 1999 2000

17 65 onion tomato sweet corn soybean

66 tomato sweet corn soybean onion

67 sweet corn soybean onion tomato

68 soybean onion tomato sweet corn

18 69 carrot wheat potato flax

70 wheat potato flax carrot

71 potato flax carrot wheat

72 flax carrot wheat potato

19 73 carrot flax potato wheat

74 flax potato wheat carrot

75 potato wheat carrot flax

76 wheat carrot flax potato

20 77 field corn field corn potato field corn

78 field corn potato field corn field corn

79 potato field corn field corn potato

21 80 field corn soybean potato field corn

81 soybean potato field corn soybean

82 potato field corn soybean potato

22 83 field corn carrot field corn potato

84 carrot field corn potato field corn

85 field corn potato field corn carrot

86 potato field corn carrot field corn

23 87 field corn potato onion dry bean

88 potato onion dry bean field corn

89 onion dry bean field corn potato

90 dry bean field corn potato onion

Monitoring Insect and Disease Problems of Commercial Carrot Fields in North Dakota

Robert W. Stack, Neil C. Gudmestad, and Beth A. Hagen, Department of Plant Pathology

Mike J. Weiss, Department of Entomology

Carrots were surveyed for two insects (aster leafhopper, Macrosteles quadrilineatus and carrot weevil Listronotus oregonensis) during the growing season of 1997.

Carrot Weevil

Carrot weevil traps (Ghidiu and VanVranken 1995) were placed the three fields that were planted to carrots last year in the Oakes area on 3 June. A total of 17 traps were placed in the three fields and examined for weevils twice a week until 20 August. No carrot weevils were detected. However, click beetles were detected in all traps from 16 to 23 June. Larvae of click beetles, wireworms, may be damaging to carrots. Therefore, the carrot weevil trap may need to be evaluated as a click beetle trap.

Aster Leafhopper

A sweep net was used to sweep weed hosts and carrots to capture aster leafhoppers. Adult leafhoppers were placed in screen cage containing oat seedlings and transported to a laboratory on the NDSU campus. The leafhoppers were removed from seedlings and placed on individually on aster seedlings (cultivars Powderpuff and Crego) for four days. The asters were then allowed to grow and examined after two weeks for symptoms of aster yellows.

A experimental PCR test was also evaluated to determine infection by aster yellows. A total of 388 leafhoppers were collected and placed on an aster seedling. Only five plants exhibited symptoms for an infection rate of 1.2% (Table 1). Although the infection rate varies for adult leafhoppers, a PCR test from carrots at Oakes after harvest indicated an infection rate of over 20%.

Carrot Roots Showing Aster Yellows Symptoms

Occurrence of symptoms of aster yellows on harvested carrots from plots which received season-long insecticide sprays and plots which received only late sprays (after Sept 1). Carrots in two plots had insecticide sprays applied throughout the season for leafhopper control. Carrots in two other plots received the same insecticide sprays only after Sept 1.

Carrots were lifted from the ground for harvest On October 31, 1997. Tops had been removed previously. All carrots in a 20 ft row in each plot were examined and scored for absence or presence of symptoms of aster yellows. On mature carrots, aster yellows symptoms are numerous fine roots along the length of the carrot ("hairy carrot") and/or proliferation of buds/shoots on the crown. A sample of these carrots tested positive for aster

Table 1. Leafhopper and aster yellows data collected in 1997.

Date	Location	Crop	No. leafhoppers collected/ aster plants infested	No. plants with aster yellows/ total no. collected & living	Notes
5/19/97	SE Corner Sect. 32 R. 59 W., T. 129 N	Alfalfa	0/0	0/0
5/19/97	SE Corner Sect. 16 R. 59 W., T. 130 N	Alfalfa	1/1	0/0	1 plant died
5/21/97	Alfalfa field in NDSU Plots	Alfalfa	0/0	0/0
5/27/97	SE Corner Sect. 16 R. 59 W., T. 130 N	Alfalfa	17/17	0/16	1 plant died
5/27/97	NE Corner Sect. 8 R. 59 W., T. 130 N	Alfalfa	0/0	0/0
5/27/97	Carrington	Unknown	14/14	2/12	2 plants died
6/1/97	Grant County	Unknown	0/0	0/0
6/5/97	SE Corner Sect. 5 R. 59 W., T.130 N	Alfalfa	1/1	0/1
6/5/97	SE Corner Sect 32 R. 59 W., T. 130 N	Alfalfa	0/0	0/0
6/9/97	Barley in last year's carrots in Oakes	Barley	1/1	0/0
6/9/97	Barley near this year's carrots in Oakes	Barley	0/0	0/0
6/12/97	New carrot field	Carrots	0/0	0/0
6/13/97	NDSU NW of weather station	Barley	14/14	1/11	3 plants died
6/13/97	NDSU East of landing lights	Barley	7/7	0/4	3 plants died
6/18/97	NDSU East of landing lights	Barley	33/33	0/33
6/19/97	This year's carrot field in Oakes	Carrots	19/19	0/18	1 plant died
6/20/07	Carrington	Unknown	0/0	0/0
6/26/97	This year's carrot fields in Oakes	Carrots	30/30	1/28	2 plants died
7/10/97	This year's carrot fields in Oakes	Carrots	120/120	0/100	20 plants died
7/14/97	This year's carrot fields in Oakes	Carrots	24/24	0/18	6 plants died
7/17/97	This year's carrot fields in Oakes	Carrots	36/36	1/29	7 plants died
8/4/97	This year's carrot fields in Oakes	Carrots	36/36	0/2	34 plants died
8/14/97	This year's carrot fields in Oakes	Carrots	36/36	1/28	8 plants died

yellows when probed using a PCR assay for the aster yellows pathogen. There was no difference in aster yellows incidence between the spray treatments, as shown by the table below. The level of aster yellows was quite high, over 20%.

The high level of aster yellows in roots suggests that the pathogen may be more of a problem than indicated by the leafhopper result s shown in Table 1.

Table 2. Percent roots showing aster yellows symptoms in carrots harvested from plots which received season-long insecticide sprays and plots which received only late sprays (after September 1) in 1997.

	% Aster yellows symptoms
Treatment	Full spray series	Late spray only
Plot 1	19.0%	23.9%
Plot 2	24.0%	21.2%
Average	21.5%	22.6%

Figure 1. Aster yellows symptoms on carrot roots harvested on October 31, 1997.

Literature Cited

1. Ghidiu, G. M. and R. W. Vanvranken. 1995. A modified carrot weevil (Coleoptera: Curculionidae) monitoring trap. Florida Entomologist. 78: 627- 630.

2. Howard, R. J., J. A. Garland, and W. L. Seaman. 1994. Diseases and pests of vegetable crops in Canada. pp. 61-80.

 

SOIL FERTILITY AND NUTRITION

Optimizing Soil Fertility for Commercial Carrot Production in North Dakota
 

Larry J. Cihacek and Ricky Abrahamson, Department of Soil Science
Chiwon W. Lee, Department of Plant Sciences

Introduction
 

Carrots grown in North Dakota are known for quality, especially high sugar content and intense pigmentation. The average root yield (30 t/ac) is much higher than that obtained elsewhere. Our carrots are well received by consumers throughout the country. While the state's carrot industry is now experiencing a setback, the potential for expanding production and sales of our products is highly recognized. As nation's leading produce companies consider moving into this region to process and market our carrots as cello-packs, sticks, dices, slices, shreds, and peeleds, a substantial increase in carrot acreage in the future is expected.

We have previously evaluated carrot cultivars suited for the region and developed some of the cultural information for the growers in the past. However, most of the production related information for carrots grown in North Dakota is not known. Soil fertility control is one of the areas that influence the quality of products. In 1997, we established an extensive field experiment program in which nitrogen and potassium levels can be optimized for carrots. In addition, we have collected soil and plant tissue samples from commercial carrot fields to determine the interaction between soil fertility and carrot root yield and quality.

Objectives

The overall goal of this research is to optimize soil fertility for the commercial production of carrots in North Dakota. The specific objectives of this work are:

1. To optimize nitrogen and potassium levels that enhance sugar content and other quality characteristics of carrots,

2. To determine the interaction between the fertilizer levels and the yield and quality of carrots grown in commercial fields, and

3. To develop procedures for efficiently monitoring the nutrient status of the field grown carrots in North Dakota.

Procedures

Field Preparation

Prior to field cultivation grid soil samples were taken in depth increments of 0-6, 6-24, and 24-48 inches. Samples were taken at a twenty-five foot spacing intervals. The results of this sampling were then used to generate maps illustrating pH, electrical conductivity, % organic matter, phosphorus concentration, potassium concentration, and nitrogen concentration of the field (Fig. 1). These maps were used to determine the most uniform areas of the field. An area on the north end of the field (bottom of map) was chosen for both the nitrogen and the potassium study. This area was characterized by greatest uniformity in both nitrogen and potassium as well as phosphorus. The field was then prepared using a field cultivator to achieve a uniform seed bed.

Plot Design

Two experiments were conducted and used to measure the simple effects of nitrogen and potassium application on carrot growth and quality. Both studies were conducted using a randomized complete block design. Six treatments were used for each experiment. Treatments for the potassium study were 0, 25, 50, 100, 150, and 200 lb K₂O acre using potassium chloride (0-0-60). Treatments of 0, 40, 80, 120, 160, and 200 lb N/acre as ammonium sulfate (21-0-0) was used in the nitrogen study. All plots in both studies were given a blanket phosphorus application at a rate of 100 lb P₂O₅/acre as superphosphate (0-46-0). The nitrogen study was given a blanket potassium application of 50 lb K₂O/acre as potassium chloride (0-0-60). The potassium study was given a blanket nitrogen application at a rate of 100 lb N/acre using ammonium sulfate (21-0-0). Both experiments had four replicates. Plots were 11 feet by 30 feet and each contained six double rows spaced at 22 inches on center. The fertilizer treatments were applied by hand within the plot area. After fertilizer treatments were conducted the field was disced once to incorporate the fertilizer.

Plant Culture
 

Uncoated carrot seed was planted using a Stanhay vegetable planter. The carrot cultivar Navajo was used in both experiments. Seeds were planted at a rate of 400,000 seeds per acre at a 1.5 inch spacing within the row. Staggered double rows were used on 22 inch center. Seeds were sown at a one-eighth inch depth. Sand was spread lightly over the tops of the rows to reduce the chances of soil crusting before emergence. Weed control was conducted by mechanical cultivation and hand weeding when needed. Grasshoppers and leafhoppers were controlled with applications of Asana XL at the labeled rate as needed. Irrigation was not needed in 1997 due to timely rain and high water table in the area.

Sample Harvest

Carrot petioles were sampled at two week intervals after they had reached the five leaf stage. Soil samples were taken concurrently to the depths of 0-6 and 6-24 inches. Plants for the nitrogen study were harvested on October 2, 1997. The potassium study was harvested on October 9, 1997. Four plots in the nitrogen study and two replicates in the potassium study were not harvested due to poor carrot stands. Tops, petioles, and roots were harvested during the final harvest. A two meter length of a double row was harvested from each plot. Soils were sampled to the depths of 0-6, 6-24, and 24-48 inches after harvest to evaluate N use by the crop.

Measurements

The petioles that were harvested during the growing season were analyzed for potassium ion (K⁺⁾ concentration and nitrate ion (NO₃^-) concentration using a Cardy meter. The remaining petioles were then dried for further analysis. The tops were washed and dried for later elemental analysis. Fresh and dry weights were determined on the tops. The roots were graded by size into nine categories. These were US #1 (over 7 inches long) and US #2 (4-7 inches long) and Cull (under 4 inches long). US #1 and US #2 were divided into widths of .75- 1 inch, 1-1.5 inches, 1.5-2.5 inches, and over 2.5 inches wide. Total weight and number of carrots was determined for each grade (Table 1). Three carrots from each grade were then analyzed for soluble sugar percent using a refractometer. These three carrots were divided into thirds and sugars were determined from the top, middle, and bottom (tip) one-third of each carrot. These root sequences were then dried for further laboratory analysis. Tops, petioles, and roots were oven-dried at 70^oC. These dried samples have been ground and will be digested using nitric acid. Analysis of total elemental content will be accomplished with an inductively coupled plasma-emission spectrometer (ICP). Dried petiole material will be analyzed for potassium and nitrate using standard extraction procedures. The dry weight contents of sugar, nitrogen, potassium, and other elemental uptake will be determined on the carrot tops and the roots from the dry matter weights and elemental concentrations from each of the components. We also evaluated sugar content on "off-the-shelf" carrot brands at local supermarkets to establish a data base for comparison with North Dakota grown carrots.

Commercial field sampling

Two carrot fields were selected near Perham, MN and one field was selected near McVille, ND (Fig. 6, 7) for season long monitoring of petiole and top nutrient content and yield. The Perham fields had areas delineated for sampling on differing landscape positions with areas located on depressional (Perham 2), backslope (Perham 1, 3, 5, 6) and summit (Perham 4) features. Sampling areas at the McVille site were selected based on plant date with McVille 1 being the first planted and McVille 4 being the last planted with one-week intervals between planting date.

Petiole and top samples were collected at two-week intervals beginning in early August and running through September. Samples were handled as previously described in the N and K rate studies.

Table 1. Preliminary summary of nitrogen effects on carrot root yield - Absaraka, 1997.

Nitrogen rate (lb N/acre)	Root yield (lb/acre x1000)
0	47.6
40	49.9
80	51.6
120	50.1
160	59.7
200	52.2

Table 2. Preliminary summary of potassium effects on carrot root yield.

Potassium rate (lb K2O/acre)	Root yield (lb/acre x1000)
0	65.8
25	48.1
50	56.5
100	52.1
150	44.2
200	40.3

Table 3. Percent soluble sugars in three commercial "Cello-Pak" carrot brands in top, middle or tip sections of root.

Brand	Soluble Sugar
		Top	Middle	Tip	Average
Wm Bolthouse Farms "Look Mom"	8.9	9.3	9.6	9.2
California Delight	7.5	7.7	7.8	7.6
Snow Picked Farms	8.4	8.7	8.5	8.5

Figure 6. A carrot production field in McVille, North Dakota.

Figure 7. A close-up picture of carrots grown for "cut-and-peeleds" in McVille, North Dakota.

Results and Discussion

N and K fertilization

Preliminary yield results for the N and K studies are shown in Table 1 (N) and Table 2 (K). For the nitrogen (N) treatments, all N treatment yields were slightly higher than the unfertilized control with the highest yield occurring at the 160 lb/A rate. For the potassium (K) treatments, all K treatments yielded less than the unfertilized control. Since only two replications of the K study were harvested, the smaller database may not show an accurate reflection of carrot response to K fertilization.

Soluble sugar content: N and K fertilization study

Sugar content of carrot roots as affected by nitrogen fertilization are shown in Figure 2. Although variability existed in the data from one N rate to another, the sugar content appears to remain relatively consistent across the range of N rates. The top 1/3 of the roots generally is 0.5% or more higher in sugar content than the bottom (tip) segment. Potassium effects on sugar content were highly variable across the range of K treatments (Fig. 3). However the sugar values were highest for the 150 lb K₂O rate and the sugar values for the bottom (tip) segment of the roots were highest for the 100 and 150 lb K/A rates.

Soluble sugar content: commercial fields

Figure 4 shows sugar content of carrot roots at harvest as affected by planting date at the McVille site. The earliest planting date (McVille 1) had the highest sugar content while the last planting date (McVille 4) had the lowest. This was the only portion of this study where sugar content in the root segments did not consistently exhibit the relationship of bottom>middle>top.
 

Figure 5 shows the sugar content of carrot roots at harvest as affected by landscape position. There appears to be a landscape relationship (Perham 2, Perham 3, Perham 4) where sugar contents at the lower landscape positions (depressional, less well-drained) were lower than at the higher landscape positions (drier, better drained). Intermediate landscape positions (Perham 1, Perham 3, Perham 5, Perham 6) were similar to or slightly lower in sugar content than the summit position. Sugar levels at the Perham site appeared to be similar or higher than the McVille site with the exception of the depressional (Perham 2) position.

Soluble sugar content: commercial brands

Table 3 shows the percent soluble sugars in three commercial carrot "Cello-Pak" brands. Significant differences exist between brands but the sugar contents of top, middle or bottom (tip) segments show a similar relationship in sugar distribution as observed in the N and K fertilization study or the commercial field study.

The percent soluble sugars in the whole root of commercial "cut-and- peel" carrot brands are shown in Table 4. Again, there are significant differences between brands in sugar content.

Analysis of mineral nutrient levels

Currently, plant tissue samples are being analyzed for mineral nutrient content and the data has not yet been summarized. This data should be available later in the spring of 1998.

We plan to conduct greenhouse trials on the effects of N and K on carrot production and anticipate conducting another field trial in 1998.

References

 

1. Benjamin, L.R., L. Peach, I.C. van Woerden, and A. Oppelaar. 1996. A technique to estimate the radial extent of active mineral absorption by individual plants in carrot stands. Journal of Experimental Botany. 47:687-692.

2. Cihacek, L.J., L.J. Swenson, and W.C. Dahnke. 1990. Soil sampling for fertilizer recommendations. NDSU Ext. Ser. Bu. SF-990.

3. Evers, A. M. 1989. Effects of different fertilization practices on the carotene content of carrot. Journal of Agric. Sci. in Finland. 61:7-14.

4. Evers, A. M. 1989. Effects of different fertilization practices on the NO₃-N, N, P, K, Ca, Mg, ash and dietary fibre contents of carrot. Journal of Agric. Sci. in Finland. 61:99-111.

5. Evers, A. M. 1989. Effects of different fertilization practices on the glucose, fructose, sucrose, taste and texture of carrot. Journal of Agric. Sci. in Finland. 61:13-122.

6. Evers, A. M. 1989. Effects of different fertilization practices on the quality of stored carrot. Journal of Agric. Sci. in Finland. 61:123-134.

7. Evers, A. M. 1989. The role of fertilization practices in the yield and quality of carrot (Daucus carota L.). Journal of Agric. Sci. in Finland. 61:329-360.

8. Hole, C.C. and A. Scaife. 1993. An analysis of the growth response of carrot seedlings to deficiency in some mineral nutrients. Plant and Soil 150:147-156.

9. Lee, C.W., R.L. Abrahamson, and R.G. Greenland. 1997. Production and marketing of vegetable crops adapted to North Dakota Conditions. Dept. of Plant Sciences, North Dakota State University. 73 pp.

10. Lund, E. D. 1994. Determination of 2-methoxy-3-alkylpyrazines in carrot products by gas chromatography/nitrogen-phosphorus detection. Journal of AOAC International. 77(2):416-420.

11. Rao, M.H. 1994. Growth, yield and quality of tomato, carrot, cauliflower as influenced by levels and sources of potassium. Journal of Potassium Res. 10:402-406.

12. Raynal-Lacroix, C., J. Bohec, F. Le-Dily, J. Le-Bohec, F. Le-Dily, and F. Villeneuve. 1994. Nitrogen nutrition of carrot. First international symposium on carrot, Caen, France, 15-16 Sep. 1992. Acta Horticulturae. 354:119-123.

13. Sharangi, A.B. and N.C. Paria. 1995. Growth, yield and qualitative responses by carrot to varying levels of nitrogen and potassium. Horticultural Journal 1995 8(2):161-164.

14. Sing, A.K. and N.C. Paria. 1996. Effect of nitrogen and potassium on some physical attributes of Pusa Kesar carrot roots. Environ. and Ecol. 14(2):408-410.

15. Singh, A.K. and A.K. Singh. 1996. Effect of nitrogen and potash on seed yield of carrot (Daucus carota L.) cv. Pusa Kesar. Crop Research Hisar. 12(2):182-184.

16. Thicoipe, J.P., D. Berry, F. Villeneuve. 1994. Spring carrots: rational use of nitrogenous fertilizer in protected crops. First international symposium on carrot. Caen, France, 15-16, Sep. 1992. Acta Horticulturae.354:111-117.

Research Progress Report on Carrot Storage

Kenneth J. Hellevang, Department of Biosystems Engineering

Objectives

 

1. Collection of information on long-term commercial carrot storage.

2. Field measurement of static pressure in a commercial storage ventilation system.

• Laboratory measurement of the pressure drop through carrots (static pressure) to provide data at varying airflow rates.
  

• Methods
  • 
    

  a. Information on carrot storage engineering was gained by an extensive literature search using electronic and conventional methods, and through consultations with personnel involved with storage construction, climate control, and management world-wide.
  
  

  b. Equipment was developed that enabled measuring the static pressure with a manometer and air velocities with a vane-anemometer in a commercial carrot storage at Oslo, MN. Static pressures were measured across the entire ventilation system, through the pile of carrots, and a various locations within an air distribution duct. Static pressures in the duct were measured at two airflow rates.
  
  c. Laboratory apparatus was developed which permitted varying the airflow rate through a column of carrots and measuring the static pressure developed below the column of carrots.
  
  Results

  a. Highlights of the information gathered on carrot storage include:
  
  Very few carrots produced in the world are stored commercially for extended periods. Carrots grown on fields where carrots were produced the previous year do not store as well as carrots from fields on which carrots have not been grown previously. Carrots should be physiologically mature. Weight loss and rotting in storage increases with increasing rainfall during the final 2 weeks before harvest. Storability of carrots greatly decreases with increasing damage during harvest and handling. Rapid hydrocooling to 32 F immediately after harvest is strongly recommended to minimize rotting in storage. Carrots should be washed then rinsed with a 200-300 ppm chlorine (5% bleach) solution before storage. Duration of storage depends on the storage temperature and relative humidity. Storage in air at 32 to 34 F and 98-100% relative humidity resulted in less quality loss and less decay. Less decay (mold) occurs in storage at 98-100% relative humidity than at lower humidity levels. Condensation on carrots caused by forced-air circulation at high relative humidity, for short periods of time, does not increase decay, but carrots should not be in liquid water for extended periods. Carrots freeze at 29.5 F. The heat of respiration of carrots listed in the literature varies from 900 to 4400 Btu/ton/day at 32 F. Air renewal is essential in storage of carrots to prevent the buildup of musty odors and carbon dioxide. Carbon dioxide levels exceeding 3% increase decay and respiration. Also sugar contents decrease with increasing carbon dioxide levels. Air circulation is required to maintain a uniform environment in the stored carrots. Carrots should never be stored with other fruits and vegetables. Little information on recommended ventilation rates, possibly 40-60 cfm/ton. The coumarins located in the bitter epidermis of the roots, the synthesis of which is promoted by storage in moist, cold conditions, appears to enhance anti-microbial resistance. Carrots have a bulk density 27 to 34 lb/cu ft. Carrot depths of up to 14 feet can be used in storage with force air circulation. Cooling coils need to be designed to limit moisture removal to maintain the required high humidity levels.

  
  b. The ventilation system, to function appropriately, needs to be designed by someone familiar with vegetable (potato) storage ventilation system design and accepted engineering practice such as EP475.1 by the American Society of Agricultural Engineers. Poor designs result in inefficient and non-uniform airflow distribution. The resistance to airflow of the carrots in a commercial storage is extremely small in comparison to the other parts of the air handling system. The static pressure measured under about 10 feet of ventilated carrots was 0.07 inch of water.
  
  c. Data is now being collected on the resistance to airflow of carrots at varying airflow rates using a laboratory apparatus.

  
  4) Activities with private sector

  
  a. Many of the people contacted for information on carrot storage were in the private sector. Some people in the private sector were not willing to share information because it was considered proprietary.
  
  b. The ventilation measurements made in this portion of the research were made in a private sector commercial storage. Additional work with another commercial storage was planned, but had to be canceled because carrots were not stored in that storage.
  

  c. Some of the carrots used in the laboratory work were donated by the private sector.
  
  

  5) Major activities planned for 1998-99
   

  Further literature review and consultations will be conducted on moisture absorption by foamed in place urethane insulation. Laboratory research to determine the moisture transfer and absorption characteristics of foamed in place urethane insulation being used in vegetable storage is planned.
  

  6) Publications
  

  A paper and presentation proposal has been submitted to present the results of the work at the International Meeting of the American Society of Agricultural Engineers in July. The information will also be published in a fact sheet.
  
  7) Literature Cited
  
  Numerous citations were included in the information gathering aspects of the study. Some of these include:

  International Society for Horticultural Science

  First International Symposium on Carrot, France, 1992

  Postharvest Physiology of Vegetables, Marcel Dekker

  Institute of Agricultural Research, Netherlands

  New Zealand Institute for Crop and Food Research

  Numerous university publications and people at universities and companies across the United States and Canada.

   

STORAGE DISEASES

Treatments to Reduce White Mold (Sclerotinia) and Other Rots in Storage

Robert W. Stack, Department of Plant Pathology

Introduction

Local carrot growers reported serious problems with decay when they attempted to store carrots for more than a two of three months. Samples of rotted carrots from two storages collected in spring 1997 were cultured in our laboratory to determine the storage pathogens involved. Two known storage rot fungi predominated, Sclerotinia sclerotiorum, cause of white mold disease of many crops, and Botrytis sp., cause of gray mold, which is a storage/shipping problem on many kinds of produce. Occurrence of Botrytis gray mold on stored carrots is related to storage conditions, especially higher than optimal temperatures and less than 100% relative humidity. Occurrence of Sclerotinia white mold on carrots in storage arises from latent infections which occur in the field, particularly on older leaf bases and other senescent tissues at the crown. We established a study to test reported control procedures to prevent white mold infection.

Procedures

Five plots of carrots in the Oakes crop rotation study were used to test if a late application of fungicide could reduce white mold in storage. Fungicide (Benomyl) was sprayed on half of each plot at the recommended rate approx 3 wk prior to harvest, the other half of each plot was not sprayed with fungicide. The five paired plots were dug in late October and carrots collected by hand. Carrots were sorted and approx 15-20 kg of carrots from each half plot were returned to the lab where they were washed, inspected and graded. Approx 12 kg of sound, washed, commercial grade carrots per half plot were packed into heavy plastic bags and placed in crates. Crates were placed in a cooler at 3 ^oC.

Results and Discussion

On Jan 16, 10 weeks after being placed into storage, a few bags were opened and the carrots examined. Nearly all were sound, and only slight traces of mold (undetermined type) were seen on a few carrots. The bags were resealed and the carrots left in storage for a further period. We plan to evaluate mold and rot on these carrots in mid-March 1998, at which time they will have been stored for 17 weeks, about the length of time that the commercial growers had reported they began seeing problems

Transformation of Carrot (Daucus carota L.) with Genes Involved in Sucrose Metabolism

Murray E. Duysen, Mingbo Qin, and Chiwon W. Lee, Department of Plant Sciences

Summary

A study was initiated to characterize key enzymes that influence sweetness in carrot (Daucus carota L.) roots. Antisense constructs of sucrose synthase (SS), sucrose phosphate synthase (SPS) and UDP-glucose pyrophosphorylase (UGPase) genes from potato (Solanum tuberosum L.) were used to transform carrot cell lines. Seedling hypocotyl sections of selected carrot lines were pre-incubated on B5 medium for 2 days, co-cultivated with A. tumefaciens LBA4404 containing the recombinant pBI121 plasmid for an additional 3 day period, and then transferred to a B5 medium containing 50 mg/mL kanamycin and 400 mg/mL carbenicillin. In 4 weeks, 18.6%, 33.3%, and 26.7% of the cultures from a breeding line (W204-C) were found to be transformed, respectively, with SS, SPS, and UGPase constructs as determined by kanamycin resistance. In contrast, no kanamycin resistant calli were obtained from a commercial cultivar (Navajo) in these transformation studies. The transformed calli proliferated in the medium containing 50 mg/mL kanamycin and 400 mg/mL carbenicillin, whereas non-transformed calli died in the same medium. Kanamycin resistant plants have been regenerated from SPS and UGPase transformed calli via embryogenesis, while no plants regenerated from SS transformation. The transformation of these regenerated plants and calli were confirmed by PCR experiment. The influence of these additional genes on sugar metabolism and accumulation in root tissues of transformed carrots will be characterized in the future.

Introduction

Sweetness in carrots is mainly influenced by sugar and volatile terpenoids. The total sugar (mainly sucrose) contents in commercial carrot roots range from 6% to 11% depending on cultivar and time of harvest. An increase of sucrose content may enhance the carrot industry, including fresh carrot supply and carrot juice production.

Sucrose phosphate synthase (SPS), sucrose synthase (Sus) and UDP-glucose pyrophosphorylase (UGPase) are thought to be the most important enzymes that control sucrose accumulation and partitioning of photoassimilate between sucrose and starch (Stitt and Quick, 1989). Sucrose synthesis can be catalyzed by either Sus or SPS. Sus converts UDP-glucose and fructose to sucrose, while SPS converts UDP-glucose and fructose-6-phosphate to sucrose-6'-phosphate and sucrose-6'-phosphate is then converted to sucrose by sucrose-6'-P phosphatase (SPP). In general, sucrose in vivo synthesis is considered to be catalyzed by SPS (in conjunction with SPP), whereas sucrose breakdown is mainly catalyzed by Sus. UGPase is not directly involved in the sucrose synthesis reaction, but it is essential to produce intermediate product, UDP-glucose, which is used by both sucrose formation and polysaccharide (starch and cellulose) synthesis. All these genes have been cloned from various plants.
Overexpression of SPS gene in transgenic plants caused increased SPS activities in several species. Transgenic tomato plants expressing the maize SPS gene had elevated leaf SPS activity and the enhanced SPS activity was associated with an in increased light- and CO₂-saturated rate of photosynthesis and, under ambient conditions, with increased ratios of sucrose to starch in leaves (Galtier et al., 1993) and increased partitioning of fixed carbon to sucrose(Micallef et al., 1991). A substantial reduction in SPS activity of potato leaves and tubers was achieved with SPS-antisense construct under the control of 35S-CaMV promoter (Huber and Huber, 1996). As a result of the antisense inhibition, sucrose synthesis in leaves and starch and amino acid syntheses were enhanced.

Transgenic plants with Sus showed that this gene is associated with sink strength (Zrenner et al., 1996), but no significant changes with sucrose accumulation has been reported with this gene. Attempts to reduce sugar content in potato tubers via antisense inhibition of UGPase have been made by different groups (Spychalla et al., 1994; Zrenner et al., 1993; Borovkov et al., 1996). The results were markedly different. Zrenner et al. Observed no change in the growth and development of transgenic plants with 95-96% reduction of UGPase activity and concluded that 4% of the wild-type UGPase was sufficient for normal growth and development. The other two groups noted a statistically significant change in the carbohydrate contents of stored transgenic tubers. Spychalla et al. showed a positive correlation between the sucrose and UGPase activity.

These studies suggested that SPS, Sus and UGPase would be the key enzymes that control the synthesis and partitioning of carbohydrates. A significant change in sugar contents could be obtained by introducing additional copies or antisense constructs of these genes into plants. This study was to produce transgenic carrots with SS, SPS, UGPase antisense constructs and examine the importance of these genes on sugar metabolism in carrots.

Materials and Methods

Gene Constructs

A 2.3 Kb fragment of sucrose synthase gene, a 1.6 Kb fragment of sucrose phosphate synthase gene, a 1.2 Kb fragment of UDP-glucose pyrophosphorylase gene were isolated from potato (Solanum tuberosum L.) genomic library and cloned into a binary vector, pBI121, in an anti-sense orientation. These anti-sense fragments are under the control of CaMV 35S promoter and a NOS terminator (Borovkov et al., 1996 and personal communication). A selective marker gene, npt-II, which provides resistance to kanamycin, is located upstream of the anti-sense inserts and driven by a NOS promoter. The recombinant plasmids, pBI121, were transformed into Agrobacterium tumefaciens LBA4404.

Plant Materials and Transformation

An inbred line, W204-C, and a widely grown carrot cultivar, Navajo, were used for this study. Seeds were germinated on MS medium with no plant growth regulators. After two weeks, the hypocotyls were sliced into 1-2 cm long segments. The hypocotyl segments were preincubated for 2 days, co-cultivated with Agrobacterium tumefaciens containing corresponding constructs and then transferred to medium containing 50 µg kanamycin and 400 µg carbenicillin and 2.5 mg/L 2,4-D. Kanamycin resistant calli were formed in 4 weeks and subcultured on the same medium for 3 months and then transferred into suspension culture (the same medium with no agar). 2,4-D was removed from the liquid medium to induce somatic embryos. The induced embryos were then transferred to solid medium to germinate.

PCR Analysis

Two primers used for PCR were: TRPL-R(CGGCAACAGGATTCAATCTTAAGA) and TPCOPY-2 (TTGTCAAGACCGACCTGTCC). TRPL-R is specific to the 3' end of NOS promoter and TPCOPY-2 is specific to the npt-II sequence. These two primers allow to amplify a 1094 bp long fragments of the npt-II sequence. The reaction was conducted in 10 µl of 1x Taq DNA polymerase buffer (Promega) supplemented with 1µmol/L of each primer, 200 µmol/L of each deoxynucleotide, 100 g template DNA and 1 unit of Taq DNA polymerase. Amplification was performed for 35 cycles consisting of 1 min at 94^oC, 1min at 52^oC and 1.5 min at 72^oC. During the last cycle the polymerization step was expanded to 7 min.

Results and Discussion

Plant Transformation

With W204-C, kanamycin resistant calli were formed in 18.6%, 33.3%, and 26.7% of the explants in 4 weeks after co-cultivated with SS, SPS, and UGPase constructs, respectively (Table 1). In contrast, no resistant calli were induced from Navajo. These calli proliferated on B5 medium supplemented with 50 µg/L kanamycin and 400 µg/L carbenicillin, while non-transformed calli died on the same medium.

Table 1. The plant transformation with potato SS, SPS, and UGPase antisense constructs for an inbred line (W204-C) of carrot.

Gene constructs	Number of explants co-cultivated	Number of explants with which resistant callus is induced	Plant transformation frequency (%)
SS	97	18	18.6
SPS	120	40	33.3
UGPase	90	24	26.7

Fig. 1. Genetic transformation of carrot (Daucus carota L.) with antisense constructs of sucrose phosphate synthase (SPS) genes. A- callus tissues after Agrobacterium -mediated transformation; B-asexual embryogenesis; C-germination of embryos, tumefaciens; D and E-plant regeneration in vitro; and F-transgenic plants grown in the greenhouse.

Regeneration via Embryogenesis

A suspension culture could be easily established by culturing resistant calli in liquid B5 medium with 2.5 mg/L 2,4-D. After 2,4-D was removed, somatic embryos were induced from resistant calli transformed with SPS and UGPase constructs (Fig. 1), whereas no embryos were formed with calli transformed with SS construct. These embryos were easily regenerated into whole plants on either solid or liquid medium. The presence of kanamycin and carbenicillin did not inhibit embryo formation and regeneration of transformed calli. Somatic embryogenesis in carrot has been very easy and used as a model system of plant development for many year. Upon removal of 2,4-D, formation of globular, heart and torpedo stage somatic embryos results.

The induction and regeneration of somatic embryos in a selective pressure (with kanamycin and carbenicillin) provides a simple and reliable method for carrot transformation. This result was consistent with a previous report by Thomas et al. (1989). The reason for failure of embryo induction and regeneration attempts with resistant calli transformed with SS constructs was unknown. It was probably caused by inhibition of sucrose synthase which is critical for sink strength (Zrenner et al., 1995).

Characterization of Transgenic Plants

The resistant calli and three regenerated plants from resistant calli with SPS and UGPase antisense constructs were used to perform the PCR amplification. The results showed that all the resistant calli and regenerated plants checked contained the npt-II sequence. These results showed that we have successfully obtained transgenic carrot plants with SPS and UGPase antisense constructs.

A further attempt to regenerate SS transformed plants and examine the impact of these introduced antisense fragments on sugar metabolism will be made. We are currently analyzing carbohydrate levels in the transgenic plants.

Current and Future Work

We have obtained the cDNA of the SS gene, of carrot from Arnd Sturm of Switzerland. We will transfer this gene in DH5 amplification. We will obtain the SPS gene of potato from Dr. Lorenzen (Plant Sciences Dept.) and transfer it into carrot. We also plan to clone the SPS gene from carrot using the base data available and oligonucleotide primers based on conserved regions of the peptide sequence. The cDNA will be isolated from carrot using RNA-PCR. We will then employ PCR-RACE (rapid amplification of cDNS ends) to obtain full-length cDNA. All these genes will be cloned into pBI 112 plasmids using techniques based on previous work (Borokov et al., 1996). The cell lines of carrot will be transformed with these genes as detailed earlier.

Literature Cited

• Borovkov, A.Y., P.E. McClean, J.R. Sowokinos, S.H. Ruud, and G.A. Secor. 1996. Effect of expression of UDP-glucose pyrophophorylase ribozyme and antisense RNAs on the enzyme activity and carbohydrate composition of field-grown transgenic potato plants. J. Plant Physiol. 147:644-652.
  
• Galtier, N., C.H. Foyer, J.L.A. Huber, T.A. Voelker, and S.C. Huber. 1993. Effects of elevated sucrose-phosphate synthase activity on photosynthesis, assimilate partitioning and growth in tomato (Lycopersicon enculentum var. UC 82B). Plant Physiol. 101:535-543.
   
• Huber, S.C. and J.L. Huber. 1996. Role and regulation of sucrose-phosphate synthase in higher plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 47:431-444.
  
• Micallef, B.J., K.A. Haskin, P.J. Venderveer, K-S. Roth, C.K. Shewmaker, and T.D. Sharkey. 1995. Altered photosynthesis, flowering and fruiting in transgenic tomato that have an increased capacity for sucrose synthesis. Planta 196:327-334.
  
• Spychalla, J.P., B.E. Scheffler, J.R. Sowokinos, and M.W. Bevan. 1994. Cloning, antisense RNA inhibition, and the coordinated expression of UDP-glucose pyrophosphorylase with starch biosynthetic genes in potato tubers. J. Plant Physiol. 144:444-453.
   
• Stitt, M., and P. Quick. 1989. Photosynthetic carbon partitioning: its regulation and possibilities for manipulation. Physiol. Plant 77:633-641.
   
• Thomas, J.C., M.J. Guiltinan, S. Bustos, T. Thomas, and C. 1989. Nessler. Carrot (Daucus carota) hypocotyl transformation using Agrobacterium tumefaciens. Plant Cell Reports 8:354-357.
   
• Zrenner, R., L. Willmitzer, and U. Sonnewald. 1993. Analysis of the expression of potato uridinediphosphate-glucose pyrophosphorylase and its inhibition by antisense RNA. Planta 190:247-252.
   
• Zrenner, R., M. Salanoubat, L. Willmitzer, and U. Sonnewald. 1995. Evidence of the crucial role of sucrose synthase for sink strength using transgenic potato plants (Solanum tuberosum L.) Plant J. 7:97-107.

Competitiveness of North Dakota Grown Carrots in Foreign Markets

Won W. Koo, Department of Agricultural Economics

Introduction

The objective of this study was to assess competitiveness of North Dakota carrots in domestic and international markets. Specific objectives were: (1) to evaluate the competitiveness of North Dakota carrots in the United States and determine the market share of North Dakota carrots, and (2) to analyze economic feasibility of exporting North Dakota carrots to Canada, Japan, and Korea.

Procedures

Two econometric models were developed to assess characteristics of carrot markets in the United States and Japan. The data for these econometric models are time series data from 1976 to 1995. The Japanese data were obtained from National Research Institute of Agricultural Economics, Japanese Ministry of Agriculture, Forestry, and Fishery, and the U.S. data from Economic Research Service, U.S. Department of Agriculture.

The U.S. carrot model contains four behavioral equations which interact one another. The equations are per capita consumption equation, production equation, import equation, and export equation. Production equation is divided into harvested area and yield equations.

Results

\A preliminary result from analysis based on this model shows that carrot production will increase faster than consumption in the United States for the last ten years. In addition, U.S. carrot imports are expected to substantially increase from Mexico under NAFTA. Therefore, unless the United States increase its export significantly, domestic carrot price is expected to decline over the next ten years. This is an important factor that North Dakota carrot producers should consider before making a major investment in carrot production.

Japanese carrot model contains three behavioral equations which interact one another. The equations are per capita consumption equation, production equation, and import equation. Like the U.S. model, production equation is divided into harvested area and yield equations. Unlike the U. S. carrot industry, Japanese carrot consumption is expected to grow faster than its production for the next ten years. Currently, per capita carrot consumption in Japan is 5.3 kg, which is smaller than the U.S. consumption (7.18 kg) for the 1976-1996 period. Japanese household consumption of carrots is expected to grow to 7.3 kg by 2005. Japanese industrial consumption of carrots is also expected to grow faster than the household consumption. As a result, Japanese imports of carrots will increase substantially.

Japan started to import carrots from Peoples' Republic of China in 1988. The imports increased from 1.1 thousand tons in 1988 to 55.6 thousand tons in 1995. Average import for the last three years was 27.7 thousand tons. The average import price of carrots for the last three years (1993-95) was 62 cents/kg in Japan, while its average domestic price was $1.4/kg. The U.S. domestic price of carrots was 29.4 cents for the same time period. This implies that U.S. carrots may be competitive in the Japanese market.

Future Research Plan

A spatial equilibrium model based on a mathematical programming algorithm will be developed to assess the competitiveness of North Dakota carrots in the U.S. market and to determine the size of the market. The United States will be divided into several carrot producing regions and consuming regions in this model. The data needed for this analysis are production costs and yields in each producing regions.

Two additional econometric models will be developed to analyze the carrot industries in Korea and Taiwan.

References

Henderson, Dennis R., C. Handy, and S. Neff. 1996. Globalization of the Processed Foods Market. Economic Research Service, U.S. Department of Agriculture, Agricultural Economic Report No. 742, Washington, DC.

Japanese Ministry of Agriculture, Forestry, and Fishery. Agricultural Statistics (various issues). Washington, DC.

Koo, Won W., J. Golz, and S. Yang. 1993. Competitiveness of the world durum wheat and durum milling industries under alternative trade policies, Agribusiness 9(1):1-14.

U.S Department of Agriculture. Agricultural Statistics (various issues). Washington, DC.

North Dakota Carrot Sensory Evaluation Results

David G. Kraenzel, Department of Agricultural Economics

Ivy A. Graf, Department of Food and Nutrition

Introduction

Baby carrots have become a popular and convenient snack food. They come packaged in handy plastic bags that allow families to have a non-fat, low calorie food at their finger-tips. Beta-carotene present in carrots is a major contributor of vitamin A, which is crucial for normal vision (http://www.carrots.org/nutrition).

A study was conducted to determine consumer acceptability and to compare America's Finest, a baby carrot grown in North Dakota, intermediately processed in Minnesota, and further processed and packaged in Winnipeg, Canada, with two leading brands of carrots grown in California. This study was a joint effort between the Food and Nutrition Department, Agricultural Economics Department, and the Institute for Business and Industry Development (IBID), NDSU. (December 3, 1997) This evaluation was conducted by Ms. Ivy Graf under the direction of Dr. Edna Holm.

Methods and Materials

The sensory evaluation was performed using a scoring method based on a 9-point hedonic scale. In the scale used, 1 equaled "dislike very much" and 9 equaled "like very much." The panel consisted of 54 faculty, staff and students at NDSU. They evaluated color, appearance, flavor, texture, and overall acceptance. The samples were placed in the same size cup; they were coded with random numbers and placed on a tray for presentation. Water was provided for cleansing the palate between evaluations of the samples. The test was conducted in the sensory evaluation facilities of the department of Food and Nutrition at NDSU.

Results and Discussion

Means were calculated from the data to determine the results of the formal sensory evaluation. America's Finest is a sound product. They scored the highest in flavor and overall acceptance. In the rest of the categories (color, appearance, and texture) they scored second place. Bolthouse scored the highest in the texture category, and the Grimmway carrot scored highest for color and appearance (Table 1). The nutritional content of carrots grown in McVille, North Dakota (America's Finest) is shown in Table 2.

Table 1. Comparison of carrots of three different brands by sensory evaluations.

	First Place	Second Place	Third Place
Brand	America's Finest (ND/MN/Canada) (Enger Farms)	Bolthouse (California)	Grimmway (California)
Overall	7.08	6.75	6.51
Color	7.02	6.30	7.54
Appearance	6.67	6.26	7.54
Flavor	7.13	6.98	5.85
Texture	7.15	7.35	7.02

Table 2. Nutritional information on North Dakota grown carrots (America's Finest).

Serving Size	About 10 carrots (78g)	% Daily Value
Amount per serving
Calories	40
Total Fat	0
Saturated Fat	0
Cholesterol	0
Sodium	0
Potassium	0
Total Carbohydrate	9g	3%
Dietary Fiber	3g	12%
Sugars	5g
Protein	1g
Vitamin A	330%
Calcium	2%
Vitamin C	8%

Update on Carrot Processing Projects

Rudy Radke, NDSU Extension Service-Barnes County

1. Red River Valley Carrot Groups Collaborate

The major project obstacles came from the fact that all four groups remained individual in processing and marketing of carrots. Each of the four groups set up processing of carrots in cello bags for table stock sales. Marketing by the groups targeted many of the same outlets and brokers were utilized. Markets became very competitive during the first year of processing and continued difficult in the second year. Brokers were able to pit one group against the other for price comparisons and the local established price moved down severely. Markets nationally were very low also but it is believed that unified marketing would have helped the four groups.

After budget problems and low prices, the groups scaled down in membership. One group has filed bankruptcy and another has disbanded during 1997 because of one partner going through bankruptcy. Several people and three processing plants remain with the facilities of the fourth being held by lenders. Fire destruction of a dehydration plant at Fosston, Minnesota in the spring of 1997 also meant the loss of 15 to 40 percent market for each of the groups.

The steep learning curve and financial losses within the four groups has caused Extension Service people and economic development directors along with lenders to work together for unity of the carrot growers. Several meetings have been held during the fall of 1997 and the winter of 97-98.The four groups represented by four people have moved toward market strategies and specialization of products to be produced by each processor. Several meetings have also been coordinated by the four representatives and their individual groups without any outside assistance.

2. Dehydration Study Undertaken

One market for carrots has been used in Fosston Minnnesota,a dehydration plant which dries potatoes and carrots has purchased carrots to sell for soup and feed mixes. This plant burned down in the spring of 1997. As a result, Terry Nennich, Extension agent in Farm Management and Commercial Horticulture from Bagley, Minnesota, met with Rudy Radke, Agricultural Diversification Specialist from Valley City North Dakota to discuss the lost market and potential for new opportunities connected with dried foods. They decided to further study the dehydration markets and assembled eleven groups from both states to organize the study.

The new group (Specialty Crop Coalition) has hired a consultant to do a phase one study of the dehydration of potatoes as a base product. If phase one of the study comes up positive, the group will trigger a phase two portion which will cover other vegetables such as carrots. The phase two will also look at freezing as an option to diversify processing markets for vegetables in the two states. Phase two will also look at dehydro, a new process which partially dehydrates and freezes. This product is being promoted to retain more of the flavor juices of the original fresh vegetable. The phase one study will be complete in the spring of 1998.

3. France Study Group Looks at New Technology

A group interested in high value crops has made tours to France to look at advanced technology in food processing. This study group has been coordinated by the Red River Trade Corridor. People from North Dakota and Minnesota have moved forward with the project by signing memorandums of understanding with two companies for further study in the fresh and wet salads markets. The companies in France deal with high quality food products. The American contingency has seen that they use low temperature/low bacteria processing, long shelf life, and no preservatives.

The potential joint venture or transfer of technology is being studied for the best possible fit in the Upper Midwest region. Commercial studies are continuing and the working group will move toward consensus within the two states to strive toward providing new markets for carrot producers and other vegetable growers.

Participants in Carrot Research during 1997-1998

Larry J. Cihacek

Department of Soil Science

North Dakota State University, Fargo, ND 58105

Phone 701-231-8572, Fax 701-231-7861, e-mail cihacek@badlands.nodak.edu

Murray E. Duysen

Department of Plant Sciences and Department of Botany

North Dakota State University, Fargo, ND 58105

Phone 701-231-7209, Fax 701-231-8474, e-mail duysen@plains.nodak.edu

Richard G. Greenland

Oakes Irrigation Research Station

P.O. Box 531

Oakes, ND 58474

Phone 701-742-2189, Fax 701-742-2700, e-mail rgreenla@ndsuext.nodak.edu

Neil C. Gudmestad

Department of Plant Pathology

North Dakota State University, Fargo, ND 58105

Phone 701-231-7547, Fax 701-231-7851, e-mail gudmesta@plains.nodak.edu

Kenneth J. Hellevang

Department of Agricultural & Biosystems Engineering

North Dakota State University, Fargo, ND 58105

Phone 701-231-7243, Fax 701-231-1008, e-mail kjh-eng@ndsu.nodak.edu

Won W. Koo

Department of Agricultural Economics

North Dakota State University, Fargo, ND 58105

Phone 701-231-7448, Fax 701-231-7400, e-mail koo@badlands.nodak.edu

David G. Kraenzel

Department of Agricultural Economics

North Dakota State University, Fargo, ND 58105

Phone 701-231-7374, Fax 701-231-1059, e-mail kraenzel@ndsuext.nodak.edu

Chiwon W. Lee

Department of Plant Sciences (coordinator)

North Dakota State University, Fargo, ND 58105

Phone 701-231-8062, Fax 701-231-8474, e-mail chlee@badlands.nodak.edu

Rudy Radke

NDSU Extension Service/Barnes County

230 4th Street NW, Courthouse - Room 204

Valley City, N.D. 58072

Phone 701- 845-8528, Fax 701-845-8538, e-mail barnes@ndsuext.nodak.edu

Robert W. Stack

Department of Plant Pathology

North Dakota State University, Fargo, ND 58105

Phone 701-231-7077, Fax 701-231-7851, e-mail stack@prairie.nodak.edu

Michael J. Weiss

Department of Entomology

North Dakota State University, Fargo, ND 58105

Phone 701-231-7924, Fax 701-231-8557, e-mail mweiss@badlands.nodak.edu

Graduate Students:

Ricky Abrahamson

Department of Plant Sciences

North Dakota State University, Fargo, ND 58105

Phone 701-231-8062, Fax 701-231-8474, e-mail riabraha@prairie.nodak.edu

Ivy A.Graf

Department of Food and Nutrition

North Dakota State University, Fargo, ND 58105

Phone 701-231-7481, Fax 701-231-7174, e-mail igraf@badlands.nodak.edu

Beth A. Hagen

Department of Plant Pathology

North Dakota State University, Fargo, ND 58105

Phone 701-231-7855, Fax 701-231-7851, e-mail brausch@plains.nodak.edu